Review



e2 627 100 human ubiquitin r d systems  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    R&D Systems e2 627 100 human ubiquitin r d systems
    E2 627 100 Human Ubiquitin R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e2+627+100+human+ubiquitin+r+d+systems/Recombinant+Human%2FMouse%2FRat+UbcH5c%2FUBE2D3+Protein%2C+CF/pm34492225-181-45-48
    Average 95 stars, based on 60 article reviews
    e2 627 100 human ubiquitin r d systems - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Recombinant:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Ubiquitin Proteomics:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Cytotoxicity Assay:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    SYBR Green Assay:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Labeling:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Sequencing:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Quantitative RT-PCR:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Expressing:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.

    Over Expression:

    Article Title: Shigella ubiquitin ligase IpaH7.8 targets gasdermin D for degradation to prevent pyroptosis and enable infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti Actin MP Biomedicals SKU: 0869100-CF, Clone C4 Rabbit polyclonal anti beta-tubulin Abcam Cat#: Ab6046, RRID:AB_2210370 Rabbit polyclonal anti IpaH9.8 EpiGentek Cat#: A55475 Mouse monoclonal anti Cul1 ThermoFisher Cat#: 32-2400, 2H4C9, RRID:AB_86218 Mouse monoclonal anti Myc Cell Signaling Cat#: 2276S, RRID:AB_331783 Mouse monoclonal anti FLAG M2Peroxidase Millipore Sigma SKU: A8592, RRID:AB_439702 Mouse monoclonal anti FLAG M2 Millipore Sigma SKU: F3165, RRID:AB_259529 Rat monoclonal anti GSDMD Aglietti et al., 2016 Clone 17G2G9, Genentech Mouse monoclonal anti Rho-1D4 University of British Colombia https://ubc.flintbox.com/ technologies/0f1ef64b-fa5d4a58-9003-3e01f6f672a6 Mouse monoclonal anti-Ubiquitin LifeSensors SKU: VU-0101, clone VU-1, RRID:AB_2716558 Human monoclonal anti K11-Ubiquitin Matsumoto et al., 2010 Genentech Human monoclonal anti K48-Ubiquitin Newton et al., 2008 Genentech Human monoclonal anti K63-Ubiquitin Newton et al., 2008 Genentech Rabbit monoclonal anti GSDMD Cell Signaling Technology Cat#: 97558S, E8G3F, RRID:AB_2864253 Rabbit monoclonal anti GSDMD(Asp275) Cell Signaling Technology Cat#: 36425S, E7H9G, RRID:AB_2799099 Mouse monoclonal caspase-4 Enzo Cat#: ADI-AAM-114 RRID:AB_10621609 Bacterial and virus strains Shigella flexneri M90T wild-type (WT) John Rohde, Dalhousie University N/A Shigella flexneri M90T wild-type (WT) GFP This study Genentech Shigella flexneri M90T DIpaH7.8 (WT) GFP This study Genentech Chemicals, peptides, and recombinant proteins Ultra-pure LPS E. coli 0111:B4 InvivoGen Cat#: 0111:B4 Egg phosphatidylcholine (Egg PC) Avanti Polar Lipids Cat#: 840051 Egg phosphatidylethanolamine (Egg PE) Avanti Polar Lipids Cat#: 840021 Egg Liss Rhod phosphatidylethanolamine Avanti Polar Lipids Cat#: 810146 Val-boroPro Millipore Sigma Cat#: 531465 Doxycycline Fisher scientific (Clontech) Cat#: NC042034 3X FLAG Peptide Millipore Sigma SKU: F4799 1D4 peptide (TETSQVAPA) Genscript Custom peptide MLN-7243 ChemieTek Cat#: CT-M7243 MLN-4924 (Pevonedistat) ChemieTek Cat#: CT-M4924 Bortezomib ChemieTek Cat#: CT-BZ001 Propidium iodide Millipore Sigma SKU: P4170 YOYO-1 Iodide ThermoFisher Cat#: Y3601 Nuclight Rapid Red Dye Essenbioscience Cat#: 4717 Congo Red Millipore Sigma SKU: C6277 Poly-L-lysine Millipore Sigma SKU: P4707 (Continued on next page) Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alt-R CRISPR-Cas9 IDT Cat#: 1081060 IpaH7.8 wild-type (recombinant) This study Genentech IpaH7.8 C357A (recombinant) This study Genentech Human GSDMD (recombinant) This study Genentech Mouse GSDMD (recombinant) This study Genentech Human E1 R&D systems Cat#: E-304-050 Human UBE2D3 R&D systems Cat#: E2-627-100 Human Ubiquitin R&D systems Cat#: U-100H-10M K11-linked tetra-Ub chains R&D systems Cat#: UC-45-025 K48-linked tetra-Ub chains R&D systems Cat#: UC-210B-025 K63-linked tetra-Ub chains R&D systems Cat#: UC-310B-025 Critical commercial assays CytoTox 96 Non-radioactive Cytotoxicity Assay Promega Cat#: G1780 Power SYBR Green Cells-to-CT Kit ThermoFisher Cat#: 4402955 Protein labeling kit RED-MALEIMIDE 2nd Generation NanoTemper SKU: MO-L014 Deposited data Shigella flexneri whole-genome sequencing This study SRA: PRJNA697993 Experimental models: Cell lines Ea.hy926 human endothelial cells Genentech gCell facility N/A Ea.hy926 GSDMD-/- CRISPR-KO cells This study N/A 293T human embryonic kidney cells Genentech gCell facility N/A HeLa human cervical epithelial cells Genentech gCell facility N/A Caco-2 human intestinal epithelial cells Genentech gCell facility N/A HeLa GSDMD-/- CRISPR-KO cells This study N/A ER-Hoxb8-immortalized murine myeloid progenitor cells Wang et al., 2006 Genentech Experimental models: Organisms/strains Nlrc4-/- mice (C57BL6/N) Mariathasan et al., 2004 Genentech Gsdmd-/- mice (C57BL6/N) Kayagaki et al., 2015 Genentech Nlrc4-/- Gsdmd-/- mice (C57BL6/N) This study Genentech Oligonucleotides Human GSDMD gRNA IDT TTCCACTTCTACGATGCCA GSDMD RT-qPCR forward primer IDT GTGTGTCAACCTGTCTATCAAGG GSDMD RT-qPCR reverse primer IDT CATGGCATCGTAGAAGTGGAAG ipaH7.8 RT-qPCR forward primer IDT CCCTGATCGTGGAGAACAATAA ipaH7.8 RT-qPCR reverse primer IDT CACGGACAGGCGATTGTTA GAPDH RT-qPCR forward primer IDT GTCTCCTCTGACTTCAACAGCG GAPDH RT-qPCR reverse primer IDT ACCACCCTGTTGCTGTAGCCAA Recombinant DNA pMIN-ducer (dox-inducible, lentiviral expression) Genscript, this study N/A pMIN-ducer Shigella effector library Genscript, Table S1, this study N/A pMIN-ducer FLAG-IpaH7.8 Genscript, this study N/A pMIN-ducer FLAG-IpaH7.8 C357A Genscript, this study N/A pCDNA3.1 (+) zeo (mammalian transient overexpression) Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 C357A Genscript, this study N/A (Continued on next page) e2 Cell Host & Microbe 29, 1–10.e1–e10, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDNA3.1 (+) zeo FLAG-IpaH7.8 LRR Genscript, this study N/A pCDNA3.1 (+) zeo FLAG-IpaH7.8 NEL Genscript, this study N/A pCDNA3.1 (+) zeo GSDMA-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMB-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMC-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-myc (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDME-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMF-myc (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-3KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-15KR1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo mmPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo hsPFD-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (human) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc1D4 (mouse) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 11-15) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 16-20) Genscript, this study N/A pCDNA3.1 (+) zeo GSDMD-nLuc-1D4 (human 5X Ala mutant, aa 21-25) Genscript, this study N/A pCDNA3.1 (+) zeo hsGSDMD-mmGSDMD16-21-1D4 (chimera) Genscript, this study N/A pCDNA3.1 (+) zeo mmGSDMD-hsGSDMD16-20-1D4 (chimera) Genscript, this study N/A pCMV-D8.9 (lentiviral packaging) Genentech N/A pCMV-VSVG (lentiviral packaging) Genentech N/A pACYC177 (bacterial kanamycin resistance cassette) Genentech N/A pKD46 (lambda red recombinase) Genentech N/A pBR322-AmpR-dasher GFP Genentech N/A Software and algorithms Prism 8 GraphPad software, LLC https://www.graphpad.com/, RRID:SCR_002798 DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html, RRID:SCR_015687 MSstats 3.16.0 Choi et al., 2014 https://github.com/MeenaChoi/UW2019- MSstats/blob/master/uw2019-msstats.



    Similar Products

    95
    R&D Systems e2 627 100 human ubiquitin r d systems
    E2 627 100 Human Ubiquitin R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e2+627+100+human+ubiquitin+r+d+systems/Recombinant+Human%2FMouse%2FRat+UbcH5c%2FUBE2D3+Protein%2C+CF/pm34492225-181-45-48
    Average 95 stars, based on 1 article reviews
    e2 627 100 human ubiquitin r d systems - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results